8 changing the scope or type of a group
Báo cáo toán học: "The maximum distinguishing number of a group" ppt
... 2; these include all groups of squarefree order Albertson and Collins’ results for Abelian and dihedral groups are special cases of nilpotent groups of class and metacyclic groups, respectively ... [8], we define a normal series for a group G to be a chain of subgroups = G0 G1 · · · Gc = G with the additional condition that each Gi G Theorem 2.2 Suppose a group G has a finite normal series = ... are realized as actions of the automorphism group of a graph on its vertex set Following Tymoczko, it seems natural to expand the notion of the distinguishing set of a group to include all of its...
- 8
- 264
- 0
Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf
... aspartate in the catalytic triad is not fully understood because several serine proteases not have an aspartate as the catalytic apparatus M NaCl However, for chymotrypsin -type serine proteases, ... state B, active state above pH 6.3 side-chain at residue 210 is dispensable, as shown by the fact that H21 0A and H210S are as active as native API with VLK-MCA as a substrate (Table 1) This means ... by the Trp169–His210 stacking, suggesting that API has a catalytic quadruple apparatus, composed of Ser194, His57, Asp113 and His210, rather than a catalytic triad ACKNOWLEDGEMENT We are grateful...
- 7
- 603
- 0
Báo cáo khoa học: Enzymatic oxidation of NADP+ to its 4-oxo derivative is a side-reaction displayed only by the adrenodoxin reductase type of ferredoxin-NADP+ reductases potx
... withdrawn, AMP was added as internal standard, and samples were analyzed by ion exchange chromatography as described above The amount of NADPO was determined on the basis of peak integration data ... (mol FprA))1 was calculated, a value comparable to the rate of NADPO formation In addition to H2O2, a small amount of superoxide was apparently produced in the reaction, as judged from the slight ... contain both NADPO and NADPH Thus, in the absence of oxidants, FprA catalyzes the disproportionation of NADP+ according to the following equation: 2NADPþ þ OHÀ ! NADPO þ NADPH þ Hþ ð1Þ As FprA has...
- 10
- 406
- 0
The Citizen-Soldier or, Memoirs of a Volunteer potx
... or the day after, if they not leave, a battle will take place Our men appear eager for the fray, and I pray they may be as successful in the fight as they are anxious for one 29 It is half-past ... generals are too d d slow (hic)." The Major is a man of excellent natural capacity, the son of Hon Thomas Ewing, of Lancaster, and brother-in-law of W T Sherman, now a colonel or brigadier-general ... was also of the party He is fifty or fifty-five years old, a thin, spare man, of very ordinary personal appearance, but of fine scientific and literary attainments For some years he was a professor...
- 143
- 535
- 0
History of Cuba; or, Notes of a Traveller in the Tropics pdf
... fine large harbors; those of Havana, Niepe and Nuevitas, are among the best The bay of Matanzas is also capacious; Cardenas and the roadstead of Sagua la Grande have plenty of water for brigs and ... Bayamo, CHAPTER I 22 Camaguey, Jagua, Cueyba, Habana and Haniguanica At the head of each was a governor, or king, of whose laws we have no record, or even tradition An unbroken peace reigned among ... Decadence of Spanish power History of Cuba The rovers of the Gulf Havana fortified The tyrant Velasquez Office of captain-general Loyalty of the Cubans Power of the captain-general Cupidity of the...
- 109
- 354
- 0
The financial reporting framework may not provide specific guidance for inclusion or exclusion of a docx
... operations, the group auditor may categorize components according to the nature of their operations, assessing risk for each category separately Such an exercise may enable the group auditor to ... list of laws and regulations relevant to the audit of the component audit as well as a list of laws and regulations relevant to the group audit A list of additional procedures that the group auditor ... auditing and assurance standards and by facilitating the convergence of international and national standards, thereby enhancing the quality and uniformity of practice throughout the world and strengthening...
- 10
- 176
- 0
Báo cáo y học: "Green tea: a new option for the prevention or control of osteoarthritis" ppt
... Administration approved therapy for the treatment of rheumatoid arthritis but not for OA due to its limited and short-term effectiveness Maintaining a balance in levels of IL-1β might be important as a ... radiation-induced inflammation-associated skin diseases including skin cancers [9,10] The physician and the patients want to understand the real targets and mechanism of action of GTPs that lead to the prevention ... treatment approach for OA, and agents such as GTPs could fill the gap In fact, complete deletion of the Il1b gene leads to disease exacerbation in a mouse model of OA, suggesting both a catabolic...
- 2
- 338
- 0
The Design and Implementation of a Log-Structured File System
... log as the most up to date ‘‘truth’’ about the state of the data on disk The main difference is that database systems not use the log as the final repository for data: a separate data area is ... increasing the amount of data lost during a crash For this paper we will assume that crashes are infrequent and that it is acceptable to lose a few seconds or minutes of work in each crash; for applications ... reserved for this purpose The separate data area of these database systems means that they not need the segment cleaning mechanisms of the Sprite LFS to reclaim log space The space occupied by the...
- 15
- 1,434
- 0
reducing the degree or intensity of, or eliminating, pollution
... or fog The dry forms are acidic gases or particulates Acid Mine Drainage: Drainage of water from areas that have been mined for coal or other mineral ores The water has a low pH because of ... Pollutants may include almost any natural or artificial composition of airborne matter capable of being airborne They may be in the form of solid particles, liquid droplets, gases, or in combination thereof ... ng Asbestos Assessment: In the asbestos-in-schools program, the evaluation of the physical condition and potential for damage of all friable asbestos containing materials and thermal insulation...
- 217
- 423
- 0
Optimization of design and operating parameters on the year round performance of a multi-stage evacuated solar desalination system using transient mathematical analysis
... is refined latent heat of vaporization of water at the condenser surface of last stage (J/kg), h fgNs is latent heat of vaporization of water at the condenser surface of the last stage (J/kg), ... condensation The outlet temperature from the flat plate collectors, latent heat and refined latent heat of vaporization of water from each stage and specific heat capacity of water from each stage are averaged ... taken as outlet temperature of the parallel combination Each flat plate collector has an area of 1.35m2 inclined at an angle equal to latitude of Chennai (13o) facing towards due south for the...
- 26
- 568
- 0
the meaning and structure of a narrative a systemic functional analysis
... of the clause; and the Rheme is the remainder of the message The Theme may be a nominal group, an adverbial group, or a prepositional phrase The Theme may be single or multiple, marked or unmarked ... for the syntactic structure of language, it prefers placing the function of language as central (what language does and how language does it) rather than placing the elements of language and their ... grammar are different from formal models of grammar by their focus on the communicative aspect of language 2.4 Metafunctions Halliday developed a theory of the fundamental functions of language...
- 39
- 826
- 2
How Is the Ku Klux Klan Like a Group of Real-Estate Agents
... he fed the information to a union friend He passed along Klan information to the assistant attorney general of Georgia, an established Klan buster After researching the Klan’s corporate charter, ... along all the information and gossip that John Brown gleaned by infiltrating the main Klan chapter, Nathan Bedford Forrest Klavern No 1, Atlanta, Realm of Georgia During the war, the Adventures of ... here: the information that people include in their ads and the level of response gleaned by any particular ad Each layer of the data can be asked its own question In the case of the ads, how forthright...
- 30
- 550
- 0
Tài liệu Báo cáo " The meaning and structure of a science fiction story: a sysyemic functional analysis " doc
... declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative ... Sayer verbal said 27 Senser mental understand 28 Actor material working 29 Actor materialswitched on 30 Actor material work 31 Sayer verbal said 32 Goal material are stuck 33 Actor material take ... relational was III Senser mental see Existent relational were Actor material descended Actor material landed Actor material put on Goal Actor material opened Goal Actor material climbed 10 Actor material...
- 18
- 712
- 4
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc
... CTGAGGTTACAGACAACTGTTC CCTTTGACATCGCAAGTGGATCA TTGAGGTGACAGACAATTGCCT TCTTTGACTTCTCAAACTGATCG GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC RPE65c-His-Fwd ... GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC GATATCTTATGGTTTGTACATCCCATGGAAAG GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC AAGCTTCTAAGGTTTGTAGATGCCGTGGAG TGGGGAGGACTTTTATGCTGT CTTTTGTGTAGGTGGGATTCG CTGAGGTTACAGACAACTGTTC ... iron-dependent Characterization of the kinetic parameters of the enzymatic activity of zebrafish RPE65c To determine the steady-state kinetics of the enzymatic activity of zebrafish RPE65c, the assay conditions...
- 14
- 753
- 0
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc
... neutral and alkaline pH; PhyH-DII was less stable under the same conditions (Fig 2D) PhyH was basically stable at 35 °C, and retained 60% of the initial activity at 45 °C for 90 when assayed at ... phosphate was released over that of PhyH-DII alone More phosphate (1.17– 2.49 fold) was also released after subsequent addition of PhyH-DI to a BPP (168PhyA or PhyP), or an HAP (E coli AppA) and ... of PhyH-DI and PhyH-DII and two times greater than that of PhyHDII This large variance cannot be ascribed to the function of PhyH-DI alone The dual-domain phytase was shown to be a dimer according...
- 9
- 801
- 0
Tài liệu Linking the Gaza Strip with the West Bank: Implications of a Palestinian Corridor Across Israel docx
... the war was the impact of a major hurricane that affected East Pakistan The apathy of the West Pakistani leadership and their failure to aid East Pakistan only aggravated an already tense situation ... member of the Arab League of States, and a signatory of the Arab Transit Agreement of 1977 In terms of this agreement, ‘Palestine’ has the right of free transit over the territories of other Arab ... fact that the West Bank and Gaza Strip are already in close proximity a demand for contiguity has already been met Presumably therefore, the meaning that advocates of safe passage attach to the...
- 64
- 307
- 0
Tài liệu Báo cáo khoa học: Binding of ligands originates small perturbations on the microscopic thermodynamic properties of a multicentre redox protein pptx
... optimization The half-height widths of the NMR signals were used as a measure of the uncertainty of each NMR data point and an experimental uncertainty of 2% was assumed for the experimental points of the ... values for the redox–Bohr interactions and the macroscopic pKa values are absolute, and therefore the macroscopic pKa values of the various redox stages show only very small modifications relative ... thermodynamic model to the NMR data (for the case of DvHc3:ZnRb), or to the NMR and UV-visible data sets simultaneously (for the case of DvHc3:Pi) using the Marquardt method for parameter optimization...
- 10
- 640
- 0
Tài liệu The Design and Performance of a Real-time CORBA Event Service doc
... Sensor Proxies If data was not availHigh Level able to be pulled, the calling I/O Facade would need to block I/O Facade I/O Facade I/O Facade Abstraction awaiting a result In order for the I/O Facade ... hardware, such as Forward Looking Infrared Radar, requires a new Sensor Proxy, I/O Facades must be altered to take advantage of the new technology ample has the following participants: Aircraft ... correlation of events For instance, an I/O Facade may depend on data from a subset of all Sensor Proxies Furthermore, it may use data from many Sensor Proxies in a single calculation of aircraft position...
- 20
- 737
- 0
Tài liệu Báo cáo khoa học: Oxygen tension regulates the expression of a group of procollagen hydroxylases docx
... significant 5¢-CGGGATCCTAGACCGGCTAACAAGTA-3¢ 5¢-GGAATTCCAAGCAGTCCTCAGCTGT-3¢ 5¢-CGGGATCCTCGGACACCCTGTAAATG-3¢ 5¢-GGAATTCCAAGCAGTCCTCAGCTGT-3¢ 5¢-CGGGATCCTGCAGGCAGAATTCTTCA-3¢ 5¢-GGAATTCCCAGTCTGTGTTCAACCG-3¢ ... 5¢-AACTGGTGGCCGAGTGGG-3¢ 5¢-GCCCATTTCAAACTTGAG-3¢ 5¢-GCACATTGGGAAACGCTA-3¢ 5¢-AATTTTGCATTTGTGATC-3¢ 5¢-CCTGTTGTGCACATTGGG-3¢ 5¢-AATTTTGCATTTGTGATC-3¢ 5¢-ACCTCAAGATGTGCCACT-3¢ 5¢-TCCATCGGTCATGCTCTG-3¢ ... 5¢-GGAATTCCCAGTCTGTGTTCAACCG-3¢ 5¢-CGGGATCCTGCAGGCAGAATTCTTCA-3¢ 5¢-GGAATTCGCTGAACTGAGAGGTTAG-3¢ 5¢-CGGGATCCAGCAGTATGGTGTCCGTG-3¢ 5¢-GGAATTCACCGTCACTTCGCTTGAG-3¢ 5¢-AACTGGTGGCCGAGTGGG-3¢ 5¢-GCAGGGTGTCATAGGCCA-3¢...
- 8
- 434
- 0
Tài liệu The Scope and Method of Economics pdf
... Sports Authority and local politicians were actively debating whether to spend taxpayers money on a new arena for the team An important part of that debate was the opportunity cost of the taxpayers' ... precisely According to Ricardo's theory of comparative advantage, specialization and free trade will benefit all trading parties, even theory of comparative advantage Ricardo's theory t h a t specialization ... in any of these variables affect large numbers of households across the country, the total number of miles driven will change model A formal statement of a theory, usually a mathematical s t a...
- 464
- 514
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008